The tumour suppressor PTEN is downregulated frequently, mutated or dropped in a number of types of tumours and congenital disorders including PHTS (PTEN Hamartoma Tumour Syndrome) and ASD (Autism Range Disorder). leads to powerful counteracting of PI3K-dependent development inhibition. N-terminally tagged GFP-PTEN-L was sharply localized in the candida plasma membrane. Point mutations of a putative membrane-binding helix located at the PTEN-L extension or its deletion shifted localization to nuclear. Also, a shift from plasma membrane to nucleus was observed in mutants at basic amino acid clusters at the PIP2-binding motif, and at the C2 and CBR3 loops at the C2 domain. In contrast, C-terminally tagged PTEN-L-GFP displayed mitochondrial localization in yeast, which was shifted to plasma membrane by removing the first 22 PTEN-L residues. Our results suggest an important role of the N-terminal extension of alternative PTEN isoforms on their spatial and functional regulation. strain YPH499 (DH5 F[K12D((wand yeast and other basic molecular biology methods were carried Dexrazoxane HCl out using standard procedures. pYES2-PTEN (amino acids 1-403) and pYES2-PTEN-L* (amino acids 22-L-576-L; amino acid nomenclature according to Pulido [32]) have been previously described [39], pYES2-PTEN-L (amino acids 1-L-576-L) was generated Dexrazoxane HCl by PCR adding to PTEN-L* the N-terminal 21 residues, pYES2-PTEN-M.1 and pYES2-PTEN-M.2 (amino acids 28-L-576-L) were constructed by mutagenic PCR from pYES2-PTEN-L*. pYES2-GFP-PTEN-L, pYES2-GFP-PTEN-M and pYES2-GFP-PTEN-L* were constructed by amplifying GFP with the primers GFP-PTEN-L-fw (CCAAGCTTATGAGTAAAGGAGAAGAA) and GFP-PTEN-L-rv (CCAAGCTTTTTGTATAGTTCATCCATGC), both designed with promoter region followed by its coding sequence with primers containing promoter. Canonical PTEN was also included for comparison (Figure 1B). Open in a separate window Figure 1 Primary structure of PTEN-L and constructs developed in this work for expression in S. cerevisiae. A. Amino acid sequence of PTEN-L marking the domains and motifs relevant for this work. Starting residues for coding sequences of PTEN-L, PTEN-M, and PTEN are highlighted (in white CPTEN-LC or red). The putative signal peptide, missing in our artificial PTEN-L* and PTEN-M constructs, is marked in orange, the poly-Arg stretch in blue, the putative membrane binding helix (MBH) in light brown, the Lys-Arg-Arg core of the PBD/NLS region in yellow, and the CBR3 and C2 loops Dexrazoxane HCl within the C2 domain in brown and green respectively, as indicated. Amino acid numbering corresponds to PTEN-L (accession “type”:”entrez-protein”,”attrs”:”text”:”NP_001291646″,”term_id”:”1520682132″,”term_text”:”NP_001291646″NP_001291646). B. Scheme of the versions of PTEN used in this work, indicating in the bottom of each depiction the canonical (M, methionine) or alternative (L, leucine; I, isoleucine) translation start codons. At the top of each depiction, the artificial M residues used to initiate the translation of some isoforms are indicated. GFP is represented in green, and the N-terminal signal peptide, poly-Arg stretch and MBH follow color codes as in A. All versions were expressed from the pYES2 yeast expression vector. Immunodetection with an anti-PTEN pan antibody demonstrated that PTEN and PTEN-L had been indicated in low amounts when compared with PTEN-L*, while PTEN-M amounts had been intermediate (Shape 2A). To comprehend whether the candida model could recognize PTEN substitute initiation codons, we produced two PTEN-M variations, one with an ATG codon in the beginning placement (PTEN-M.1) as well as the other using the Ile-encoding substitute initiation codon (PTEN-M.2). Oddly enough, both forms had been indicated likewise, even though the PTEN-M.2 edition displayed a slower Rabbit Polyclonal to CYTL1 mobility. On the other hand, changing the Met constantly in place 1 of traditional brief PTEN, to Ile, resulted in total insufficient manifestation (Shape 2A). This shows that, as reported for higher cells, candida can read substitute begin codons in the PTEN-L mRNA, however the PTEN ATG is vital for manifestation of brief canonical PTEN. Changing of Ile28-L to Ala (I28A-L), nevertheless, didn’t influence manifestation of PTEN-L* or PTEN-L, indicating that the artificial Met codon drives manifestation of these variations whatever the substitute Ile28-L begin codon (Physique 2A). PTEN-L* was expressed in higher levels than PTEN-L and -M. Functionally, the I28A-L PTEN-L mutant was less efficient rescuing PI3K-induced growth inhibition (Physique 2B), an effect that was not patent in PTEN-L*, likely due to its high expression levels. This suggests that the Ile28-L residue is usually important for the function of PTEN-L, but only when expression is limited. Open in a separate window Physique 2 Expression in yeast of N-terminal extended PTEN variants. A. Immunoblots on lysates obtained from yeast transformants expressing the indicated versions of PTEN. The same membrane was hybridized with anti-PTEN antibodies (upper.