Calcium-dependent protein kinases (CDPKs) have been shown to be involved in abscisic acid (ABA)-mediated physiological processes, including seed germination, post-germination growth, stomatal movement, and plant stress tolerance. of the expression and the activities of superoxide dismutase (SOD) and ascorbate peroxidase (APX), and in the production of H2O2. Further, ZmCPK11 was shown to be required for the up-regulation of the expression and the activity of ZmMPK5 in ABA signalling, but ZmMPK5 had very little effect on the ABA-induced up-regulation of the expression and the activity of ZmCPK11. Moreover, the transient gene expression analysis in combination with the transient RNAi test in protoplasts showed that ZmCPK11 acts upstream of ZmMPK5 to regulate the activities of antioxidant enzymes. These results indicate that ZmCPK11 is usually involved in ABA-induced antioxidant defence and functions upstream of ZmMPK5 in ABA signalling in maize. (Cheng increases NADPH oxidase activity and ROS production in tomato protoplasts (Xing and under salt stress, and reduce the salt-induced accumulation of H2O2 (Asano are involved in ABA signalling (Colcombet and Hirt, 2008; Xing (Xing L. cv. Nongda 108; from Nanjing Agricultural University, China) were sown in trays of sand in a light chamber at a temperature of 22 C (night) to 28 C (day), photosynthetic active radiation of 200 mol mC2 sC1, and a photoperiod of 14/10h (day/night), and watered daily. For protoplast isolation, maize plants were Rabbit Polyclonal to TRAF4 produced at 26 C under dark conditions. When the second leaves were fully expanded, they were collected and used for investigations. The plants were excised at the base of the stem and placed in distilled water for 4h to eliminate wound stress. After treatment, the cut ends of the stems were placed in beakers wrapped with aluminium foil made up of 100 M ABA, 10% (w/v) polyethylene glycol (PEG 6000), 10mM H2O2, or 10mM CaCl2 for the indicated time, with a continuous light intensity of 200 mol mC2 sC1. To study the effects of inhibitors, the detached plants were pre-treated with 100 M diphenyleneiodonium chloride (DPI), 10mM dimethylthiourea (DMTU), 200U of CAT, 100 M trifluoperazine (TFP), 10mM ethylene glycol-bis(2-aminoethyl ether)-for 30min at 4 C, the supernatants were transferred into new tubes, immediately frozen with liquid N2, and AZD8055 stored at C80 C. Protein content was decided according to the method of Bradford (1976) with bovine serum albumin (BSA) as standard. For immunocomplex kinase assay, protein extract (100 g) was incubated with anti-ZmCPK11 antibody (2 g) or anti-ZmMPK5 antibody (2 g) in an immunoprecipitation buffer as described previously (Zhang (GenBank accession no. “type”:”entrez-protein”,”attrs”:”text”:”AAP57564.2″,”term_id”:”38000010″,”term_text”:”AAP57564.2″AAP57564.2), forward CCTCCACGACCCCGACAATG and reverse ACCTCTCCGAG CACCCCAAC; (GenBank accession no. “type”:”entrez-protein”,”attrs”:”text”:”BAA74734.1″,”term_id”:”4239889″,”term_text”:”BAA74734.1″BAA74734.1), forward ACTGATGGACCGCAAACC and reverse GGGTGACG AGGAAGTTGG; (GenBank accession no. “type”:”entrez-nucleotide”,”attrs”:”text”:”X17565″,”term_id”:”22483″,”term_text”:”X17565″X17565), forward TGGAGCACCAGAAGATGA and reverse CTCGTGTCC ACCCTTTCC; (GenBank accession no. “type”:”entrez-nucleotide”,”attrs”:”text”:”EU969033″,”term_id”:”195643365″,”term_text”:”EU969033″EU969033), forward TGAGCGACCAGGACATTG and reverse GAGGGCTTTGTCA CTTGGT; and (GenBank accession no. “type”:”entrez-nucleotide”,”attrs”:”text”:”J01238″,”term_id”:”168403″,”term_text”:”J01238″J01238), forward GTTTCCTGGGATTGCCGAT and reverse TCTGCTGCTGA AAAGTGCTGAG. Each PCR (20 l) AZD8055 contained 10 AZD8055 l of 2 Real-time PCR Mix (made up of SYBR Green), 0.2 M of each primer, and appropriately diluted cDNA. The thermal cycling conditions were 94 C for 30 s followed by 40 cycles of 94 C for 10 s, 60 C for 20 s, and 72 C for 20 s. To standardize the data, the ratio of the absolute transcript level of the target genes to the absolute transcript level of was calculated for each sample. The relative expression levels of the target genes were calculated as -fold changes relative to the appropriate control experiment for the different chemical treatments. Plasmids AZD8055 The full-length cDNA fragment was amplified with the (CaMV) 35S promoter and yellow fluorescent protein (YFP) of the pXZP008 vector. AZD8055 The primer pairs were: forward synthesis of dsRNA DNA templates were produced by PCR using primers made up of the T7 promoter sequence (5-TTAATACGACTCACTATAGGG AGG-3) on both the 5 and 3 ends. The primers used to amplify DNA of were: forward TAATACGACTCACTATA GGGAGACCACTGACTTTGGGCTTTCC and reverse TAATA CGACTCACTATA GG GAGACAGCTTCTGGACCATAGCAT. The PCR conditions were as follows:.