We recently reported that blockade of the CD40CCD154 ligand interaction with the cross-reacting mouse anti-human CD154 antibody, 5c8, together with donor-specific transfusion led to enhanced but not completely successful engraftment in a canine model of DLA-identical marrow transplantation after 100cGy total body irradiation (TBI). 1997; Hogan et al., 2003). However, A-443654 when TBI conditioning was decreased to 1 1 Gy, all dogs eventually rejected their grafts. Extended and sustained engraftment was accomplished in most but not all dogs when 1 Gy TBI was preceded by intravenous injections of both peripheral blood mononuclear cells (PBMC) from the marrow donor and the T-cell costimulatory blockers recombinant human (rh) CTLA4-Ig or cross-reacting mouse anti-human CD154 antibody 5c8 (Storb et Rabbit Polyclonal to CLIC6. al., 1999; Jochum et al., 2007). One possible explanation for the lack of uniform success might be reduced affinity of these cross-reacting anti-human products for canine cell surface determinants. A-443654 Therefore, we focused on developing a canine specific reagent to block the CD40CCD154 interaction. Instead of generating an anti-CD154 monoclonal antibody, we developed a canine specific fusion protein, CD40-Ig. In other similar studies, CD40-Ig has been shown to be active with human (McLellan et al., 1996) cells and in rodent models of liver (Nomura et al., 2002), heart (Guillot et al., 2002), and other organ transplantation models (Jin and Xie, 2003; Kanaya et al., 2003; Yamashita et al., 2003). 2. Materials and Methods 2.1. Experimental animals and blood cell preparations Beagles, mini-mongrel, basenji, and golden retriever crossbreeds used for all experiments were raised at the Fred Hutchinson Cancer Research Center (Seattle, WA, USA) or purchased from commercial kennels. PBMC were isolated on Ficoll-Hypaque (density 1.074). Lymph node and A-443654 tonsil cells were obtained from dogs, which were euthanized for other reasons. 2.2. Cloning of the extra cellular domain of canine CD40 Oligonucleotides were custom-made by Invitrogen (Carlsbad, CA, USA). Total RNA was isolated from the lymph node, tonsil, and thymus using TRIzol reagent (Invitrogen). cDNA was synthesized using M-MLV reverse transcriptase (Invitrogen) and oligo (dT) primer (Promega, Madison, WI, USA). The cDNA of CD40 was synthesized by RT-PCR using Platinum PCR Supermix (Invitrogen) and a forward primer (CGGGAATATTACGGGGAACT) and a reverse primer (CCACTGAATCACAAACAATGCC) based on the GenBank sequence (“type”:”entrez-nucleotide”,”attrs”:”text”:”AY333789″,”term_id”:”32700004″,”term_text”:”AY333789″AY333789) of CD40 mRNA. The PCR product was isolated from an agarose gel using QIAquick Gel Extraction kit (Qiagen, Valencia, CA) and ligated into the pGEM-T Easy vector (Promega, Madison, WI) for sequencing. DNA sequencing was performed with an automated sequencer by PCR amplification using BigDye terminator v3.1 reagents (Applied Biosystems, Foster City, CA) and T7 and SP6 promoter primers (Promega)E 2.3. Cloning of murine IgG2a The cDNA of murine IgG2a was isolated from the IgG2a-secreting mouse myeloma cell line RPC5.4 (ATCC, Manassas, VA) by RT-PCR using Platinum PCR Supermix and a forward primer (TAAAGAGCCCAGAGGGCCCACAATCAA) and a reverse primer (TCATTTACCCGGAGTCCGGGAGAA) based on the GenBank sequence (“type”:”entrez-nucleotide”,”attrs”:”text”:”V00798″,”term_id”:”51835″,”term_text”:”V00798″V00798) of mouse gamma 2a immunoglobulin heavy chain. The PCR product was isolated and ligated into the pGEM-T Easy vector (Promega, Madison, WI) for sequencing as outlined above. 2.4. Assembly of canine CD40 murine Ig fusion vector A-443654 An AflII and HindIII restricted PCR product of the signal peptide and extracellular domain of CD40 was generated from CD40 cDNA using forward (CATTAGCTTAAGATGGTTCTCCTGCCTCTGCGC) and reverse (TCCGGGAAGCTT-GGCTCTTAACCGAGGCTGGGG) primers. A HindIII restriction site and a Gly4Ser linker were added at the 5 end of the hinge region and a NotI restriction site was added at the 3 end of the CH3 region of murine IgG2a using forward (ATAATTAAGCTTGGAGG-TGGAGGTAGTGAGCCCAGAGGGCCCACATC) and reverse (CCATTATAGCGGCCG-CTCATTTACCCGGAGTCCGGGA) primers, respectively (Figure 2). Following gel purification, PCR products were digested with the appropriate restriction enzymes and ligated into AflII and NotI digested pcDNA3.1 (+) (Invitrogen). Plasmids from DH5 (Invitrogen) transformants were sequenced with T7 forward and BGH reverse primers. Figure 2 Schematic diagram of CD40-Ig expression vector containing the leader and extracellular domain of canine CD40 fused to a Gly4Ser linker and the hinge A-443654 through CH3 regions of murine IgG2a. 2.5. Cell culture and protein production CHO cells deficient in the gene (CRL-9096; ATCC) were co-transfected with linearized canine CD40/murine Ig2a/pcDNA3.1 and.
Tag Archives: Rabbit Polyclonal to CLIC6.
Categories
- 34
- 5- Receptors
- A2A Receptors
- ACE
- Acetylcholinesterase
- Adenosine Deaminase
- Adenylyl Cyclase
- Adrenergic ??2 Receptors
- Alpha2 Adrenergic Receptors
- Annexin
- Antibiotics
- ATPase
- AXOR12 Receptor
- Ca2+ Ionophore
- Cannabinoid
- Cannabinoid (GPR55) Receptors
- CB2 Receptors
- CCK Receptors
- Cell Metabolism
- Cell Signaling
- Cholecystokinin2 Receptors
- CK1
- Corticotropin-Releasing Factor1 Receptors
- DHCR
- DMTases
- DNA Ligases
- DNA Methyltransferases
- Dopamine D1 Receptors
- Dopamine D3 Receptors
- Dopamine D4 Receptors
- Endothelin Receptors
- EP1-4 Receptors
- Epigenetics
- Exocytosis & Endocytosis
- Fatty Acid Synthase
- Flt Receptors
- GABAB Receptors
- GIP Receptor
- Glutamate (Kainate) Receptors
- Glutamate (Metabotropic) Group III Receptors
- Glutamate (NMDA) Receptors
- Glutamate Carboxypeptidase II
- Glycogen Phosphorylase
- Glycosyltransferase
- GnRH Receptors
- Heat Shock Protein 90
- hERG Channels
- Hormone-sensitive Lipase
- IKK
- Imidazoline Receptors
- IMPase
- Inositol Phosphatases
- Kisspeptin Receptor
- LTA4 Hydrolase
- M1 Receptors
- Matrixins
- Melastatin Receptors
- mGlu Group III Receptors
- mGlu5 Receptors
- Monoamine Oxidase
- Motilin Receptor
- My Blog
- Neutrophil Elastase
- Nicotinic (??4??2) Receptors
- NKCC Cotransporter
- NMU Receptors
- Nociceptin Receptors
- Non-Selective
- Non-selective 5-HT
- OP3 Receptors
- Opioid, ??-
- Orexin2 Receptors
- Other
- Other Oxygenases/Oxidases
- Other Transcription Factors
- p38 MAPK
- p53
- p56lck
- PAF Receptors
- PDPK1
- PKC
- PLA
- PPAR
- PPAR??
- Proteasome
- PTH Receptors
- Ras
- RNA Polymerase
- Serotonin (5-HT2B) Receptors
- Serotonin Transporters
- Sigma2 Receptors
- Sodium Channels
- Steroid Hormone Receptors
- Tachykinin NK1 Receptors
- Tachykinin NK2 Receptors
- Tachykinin, Non-Selective
- Telomerase
- Thyrotropin-Releasing Hormone Receptors
- Topoisomerase
- trpp
- Uncategorized
- USP
Recent Posts
- Subsequent studies demonstrated that IL-17A also enhances development of colitis associated cancer (CAC) induced by the pro-carcinogen azoxymethane (AOM) and the irritant dextran sulphate sodium (DSS) (Hyun et al
- The importance of the interaction between IgG and Fc receptors has been demonstrated in experimental models, whereby there is a diminished macrophage effector function induced after IgG1-mediated phagocytosis in Fc chain knock-out mice [18]
- One of the most intensive studied glycoprotein carrying O-mannosyl glycans is -DG
- Only mild glomerular abnormalities were observed, in a minority of the glomeruli examined
- To note that the anti-PCP IgG2/anti-PCP IgG ratio was similar in HEU and HUU infants (0
Tags
a 67 kDa type I transmembrane glycoprotein present on myeloid progenitors
and differentiation. The protein kinase family is one of the largest families of proteins in eukaryotes
Apoptosis
bladder
brain
breast
cell cycle progression
cervix
CSP-B
Cyproterone acetate
EGFR) is the prototype member of the type 1 receptor tyrosine kinases. EGFR overexpression in tumors indicates poor prognosis and is observed in tumors of the head and neck
EM9
endometrium
erythrocytes
F3
Goat polyclonal to IgG H+L)
Goat polyclonal to IgG H+L)Biotin)
GRK4
GSK1904529A
Igf1
Mapkap1
monocytes andgranulocytes. CD33 is absent on lymphocytes
Mouse monoclonal to CD33.CT65 reacts with CD33 andtigen
Palomid 529
platelets
PTK) or serine/threonine
Rabbit Polyclonal to ARNT.
Rabbit polyclonal to BMPR2
Rabbit Polyclonal to CCBP2.
Rabbit Polyclonal to EDG4
Rabbit polyclonal to EIF4E.
Rabbit polyclonal to IL11RA
Rabbit polyclonal to LRRIQ3
Rabbit Polyclonal to MCM3 phospho-Thr722)
Rabbit Polyclonal to RBM34
SB 216763
SKI-606
SNX-5422
STK) kinase catalytic domains. Epidermal Growth factor receptor
stomach
stomach and in squamous cell carcinoma.
TNFSF8
TSHR
VEGFA
vulva